Search results

Hello I was thinking of buying a GMC Denali road bike from Walmart for 150 and I was wondering should I get it shipped to my home in parts and I assemble or do I let Walmart assemble it and go pick it up please reply! Thank you

when im downloading a torrent file on utorrent softwear it tells me theres seeds 1 of 2 connected 2 in swarm. peers 33 of 100 connected 30 in swarm, i no what seeds are and peers but what does 1 of 2 connted and 2 in swarm mean? same with peers

i just want to improve my %

Why did he make the reader wait for 33 Cantos before they meet the Devil? What is particularly ironic about that meeting? How does Dante present the Devil

Hello Im planning to do a hitchhike for charity in may from Bristol to Cumbria (M5/M6) So not a bad route , i play darts to the West of England and we are playing Cumbria so thought i would combine the two. Is there any tips i should know or any tried and tested means or is this a good route as...

Hi! I would really appreciate if someone could answer my question, below. A section of one nucleotide chain in a DNA that is used for transcription have the following sequence of nitrogen base. --------------------------------------------------------> GTTACGAAGAATGAAAACGTATTCC a, What does...

Ok, so I need a 2 way radio that I could put a 2.5mm headset into it. So basically a walkie talkie with a 2.5mm itin trance. And a cheap one on amazon too. And that is a 1 pin too thank you

I have a Boost Mobile Motorola i1 with Android 1.5 Cupcake, and would like to upgrade to android 2.2 or 2.3.3. Boost Mobile chose not to include this phone with updates, so I would like to do it manually. I have already rooted my phone, but I can't find any useful sites to help me. Any sites...

Yak Yak Yak Yak YakkityYak!!! That's all that wimmin do at work... AAAARRRGGH!!!

It worked better than I expected. After half an hour, I had a hole in each hand.

The dog had dug her up again.

All I see in Ohio are BMW snd HD.

Ok me and my ex have been seperated for 4 months now and had a really good relation ship going then towards the end started fighting over dumb stupid stuff and after that we stoped talking to each other for 2 weeks because she said she. Needed time to think after that we broke up I was fine...

Well I have lately been hearing of this thing called "Creepypasta" and I was thinking it might suit this party we are having. Sounds tasty. So does Creepypasta taste good if so then how much does it cost?

My son's Alpine head unit with pioneer 800w amp and 15" kicker shuts off when played very loud, turn volume down it plays fine. We have a 1 fared capaciter and a 2nd battery.

I recently pre-ordered bio shock infinite which came with a code for industrial revolution to be entered on a website. i entered the code but then i saw there was a special edition and was wondering if i could still switch the pre order over. the one i got...

So yesterday I went to Mt.Fuji area and got some stunning images. It is quite rare to get Mt.Fuji on a cloudless day with blue skies and snow on the cap! So I have these images that are in RAW. I want to crop a little and touch up a little and then save in different formats in separate folders...

Hi Folks I'm a guy in a happy long term relationship (10years) with a great woman. When I was younger (teens and early twenties) I was confused over my sexuality. I always enjoyed doing stuff with girls but I also questioned whether I was also attracted to guys and if I was bi. I have never...

ok so which is deeper and louder? between the 1 18" Solo X or 2 12" l7s? and will the 18 Solo X fit ported in a 95 ext cab tacoma? (both would be ported.) PLS ANSWER... ok thank you guys ill prob go with the 2 12s but what would you guys do?

Running Master of Orion 2 on windows 7 64 bit and need help making a shortcut for it so it will run the instructions to start it up. my problem is that it wont run unless I mount a fake cd drive (its on my laptop and i dont want to cary cds around for it) then mount the fake c drive, then...