Recent content by David

  1. D

    Walmart road bike help?

    Hello I was thinking of buying a GMC Denali road bike from Walmart for 150 and I was wondering should I get it shipped to my home in parts and I assemble or do I let Walmart assemble it and go pick it up please reply! Thank you
  2. D

    torrents and seeds and peers?

    when im downloading a torrent file on utorrent softwear it tells me theres seeds 1 of 2 connected 2 in swarm. peers 33 of 100 connected 30 in swarm, i no what seeds are and peers but what does 1 of 2 connted and 2 in swarm mean? same with peers
  3. D

    Why Dante's inferno has been described as "a polyphonic world"?

    Why did he make the reader wait for 33 Cantos before they meet the Devil? What is particularly ironic about that meeting? How does Dante present the Devil
  4. D

    Hitchhiking / Hitch Hiking in the UK tips & Faqs?

    Hello Im planning to do a hitchhike for charity in may from Bristol to Cumbria (M5/M6) So not a bad route , i play darts to the West of England and we are playing Cumbria so thought i would combine the two. Is there any tips i should know or any tried and tested means or is this a good route as...
  5. D

    Biology- transcription?

    Hi! I would really appreciate if someone could answer my question, below. A section of one nucleotide chain in a DNA that is used for transcription have the following sequence of nitrogen base. --------------------------------------------------------> GTTACGAAGAATGAAAACGTATTCC a, What does...
  6. D

    I need a 2 way radio?

    Ok, so I need a 2 way radio that I could put a 2.5mm headset into it. So basically a walkie talkie with a 2.5mm itin trance. And a cheap one on amazon too. And that is a 1 pin too thank you
  7. D

    Does anyone know how to install Android 2.2 Froyo on a rooted Motorola i1?

    I have a Boost Mobile Motorola i1 with Android 1.5 Cupcake, and would like to upgrade to android 2.2 or 2.3.3. Boost Mobile chose not to include this phone with updates, so I would like to do it manually. I have already rooted my phone, but I can't find any useful sites to help me. Any sites...
  8. D

    Y do birds yak more at work more than men, therefore being less productive?

    Yak Yak Yak Yak YakkityYak!!! That's all that wimmin do at work... AAAARRRGGH!!!
  9. D

    I tried to chat up a couple of catholic girls yesterday, by telling them I was jesus.?

    It worked better than I expected. After half an hour, I had a hole in each hand.
  10. D

    MDoes Kawasaki still make police motorcycles.?

    All I see in Ohio are BMW snd HD.
  11. D

    How to talk to my ex girlfriend again and get back with her ?

    Ok me and my ex have been seperated for 4 months now and had a really good relation ship going then towards the end started fighting over dumb stupid stuff and after that we stoped talking to each other for 2 weeks because she said she. Needed time to think after that we broke up I was fine...
  12. D

    Does Creepypasta taste good?

    Well I have lately been hearing of this thing called "Creepypasta" and I was thinking it might suit this party we are having. Sounds tasty. So does Creepypasta taste good if so then how much does it cost?
  13. D

    Stereo shuts down when volume is high?

    My son's Alpine head unit with pioneer 800w amp and 15" kicker shuts off when played very loud, turn volume down it plays fine. We have a 1 fared capaciter and a 2nd battery.
Back
Top