The protein sequence A is encoded in the DNA sequence B.
For example: a protein sequence FICEDDPKQR is encoded in the
() part of the DNA sequence
ATGAAAATT(TTCATTTGCGAAGACGATCCAAAACAAAGA)GAAAACATGGTTACC
I wanner use Perl to extract the encoding part and save it into a new DNA sequence file
For example: a protein sequence FICEDDPKQR is encoded in the
() part of the DNA sequence
ATGAAAATT(TTCATTTGCGAAGACGATCCAAAACAAAGA)GAAAACATGGTTACC
I wanner use Perl to extract the encoding part and save it into a new DNA sequence file