Search results

Write a Perl program that given a DNA string, prints out the 20 characters upstream of the start codon ATG. That is, given: $dna = "CCCCATAGAGATAGAGATAGAGAACCCCGCGCGCTCGCATGGGG"; print out: The 20 bases upstream of ATG are AGAGAACCCCGCGCGCTCGC The following script is what I have, print...

Create a "mutation": replace "Gly" with "Asp" (have your program look for Gly by using a loop and replace it with Asp if found). Print the resulting array.

i really want and iphone 4 but i have verizon adn now that they have it i want to get it so i need to know how much they pay for internet cuz on blackberrys it used to be 30 but not its 15 ?

ah i had my wisdom teeth removed and i have taken my meds and everything but it is still bleeding...is this ok or what im freaking out well i had 4 of my wisdom teeth removed and they had a lot of trouble taking out the two bottom ones...should i take the gauze off to sleep?

I'm 14, female, 5'7 and have been drinking boost plus calories 2-3 times a day for i think 2 months or something now. i went from 111 to 123, but my mom says that i'm going to have a weight problem when i'm older if i continue drinking them. Is what i'm doing unhealthy?

I'm 14 years old, i am female and i started drinking Boost Plus to gain weight. I do hip hop dance, and i exercise on a regular basis but my mom always tells me that when i'm older, i'm gonna have a weight problem and when i start gaining weight i won't stop. is this true? Right now i'm 5'7...

............. signed up P & S ?? Mine have improved as now I know how to peel and eat properly, various exotic fruits.

i had a buckle fracture in my right arm about four years ago. first off we didn't know it was broken so i didn't go to the doctor until a day or so after & i tried to shoot a basketball with it the day after i broke it. then when i went to the ER they put it in a plaster/ace bandage cast & i had...

It's our last year at high school and I have to ask my boyfriend to Tolo, the dance where the girls ask the guys. Because it's not a surprise who is asking him, I wanted it to be a surprise how I ask him. He's going to be looking for the 4 letters T-O-L-O over the next few weeks. For one, I...

...of blindness and sight? my essay has to have 4 body paragraphs

where can you find Nintendo 64 games? besides on eBay

the key from the ignition does not work for it. my remote is ruined so that wont open it anymore. i looked in the glove compartment but there was nothing there. theres also no lever to pull by the drivers seat. what can i do??? :(

etc) in the morning? ..or at any time during the day? Or is it just me? I eat like a flippin' oinky oinky piglet when I have it. But if I skip it..I swear I eat 1/3 less.

of the enlighenment? im having trouble with this question. someone please help me! if you can give me any refrences or any websites that might help id greatly apreciate it! Thank You =)