BIOLOGY - Sketch the protein that is coded by the following DNA sequence.?

K

Kayeee

New member
the protein is coded by the DNA sequence CCTGAAGGTACGTTAGTTGACATGACG

To make this sketch remember that a short chain of amino acid "looks" like a string--and it's flexible like a string too. If you allow 1/2 inch of the string to represent one amino acid, nine amino acids would make the string 4 1/2 inches long. But before drawing, please note that cysteine likes to form a bond with any other nearby cysteine molecule it can find. If there are two cysteines in your peptide, bend the "string" in order to bring the two cysteines together. This might make your straight string of amino acids curve into an "O" or maybe a "6," depending on where the two cysteines are.

My amino acids are as follows in order:
glycine (CCU)
leucine (GAA)
proline (GGU)
cysteine (ACG)
asparagine (UUA)
glutamine (GUU)
isoleucine (GAC)
tyrosine (AUG)
cysteine (ACG)


I'm just not exactly sure on how I should draw it...I'm having a bit of a brain fart...PLEASE HELP!!

do I draw something like this?


.....|
...CCU
.....|
...GAA
.....|
...GGU
.....|
...ACG --- ACG
.....|................\
...UUA...........AUG
.....|..................|
...GUU -------- GAC
 
Back
Top