Search results

  1. Y

    who should the sacramento kings get in the 2010 draft in the nba if they get...

    ...number 1 pick? i dont know alot bout college bball but i heard about demarcus cousins. i heard that he is similar to al jefferson who is just a complete beast in the paint. fyi the kings really need a big man (no point guards or shooting guards) and who do you think the kings should trade and...
  2. Y

    Biology help...before the Exam...?

    ____________Protest, plants, fungi, animals Large DNA in nucleus bounded by membrane Genome made up of several chromosomes Cell division by mitosis and meiosis Sexual reproduction common Most forms are ____________ Mitochondria and other organelles present Most are ____________ (require oxygen)...
  3. Y

    Grade 11 Biology Help (Before the Exam !i)?

    SIX KINGDOMS Kingdom – the largest classification of all living things first applied by ____________ Aristotle first classified the Kingdoms ____________ and ____________. MICRO-ORGANISMS Some micro-organism have characteristics of both animal and plant so named this kingdom ____________...
  4. Y

    Genetic Codon (Biology help)?

    Write the base sequence for the mRNA that would be formed from transcription. TACCCTTGCATACGTCTGACATAAAAAAGG ~THANK YOU~
  5. Y

    plz plz Biology Help (Best Answer for 10 points)?

    1. Do all tubes and tubules of the bronchial tree have cartilage rings? Explain. 2. What is the function of the cilia and goblet cell. 3. Define alveoli. 4. What is the % of oxygen entering the air sacs and what is the % of oxygen leaving the air sacs. What is the % of carbon dioxide entering...
  6. Y

    Biology Grade 11 (Dihybrid Cross)?

    1. Nemo decides to expand his business by breeding seahorses. Nemo has an Orange seahorse with a green snout, but he finds out that Orange seahorses with yellow snouts were in high demand. Nemo closed shop early and swam deep in to the ocean where seahorses are found. He found 9 baby seahorses...
  7. Y

    Biology Help !!! plz?

    ~~~~~~~~~~~~~~~~~~~~True Or False~~~~~~~~~~~~~~~~~~~~ 1. The synthesis reactions use carbon dioxide. 2. The calvin cycle produces PGAL. 3. Glycolysis takes place in the matrix of the mitochondria. 4. Most of the energy in glucose is related as ATP by the electron transport chain. 5...
  8. Y

    Heeeelp Biology Question !!! 10 points if u answer...?

    1. What is transcription? 2. What does 'm' in mRNA stand for? 3. What is mRNA, and what is it's function? 4. As the tow strands of the DNA separate from one onther, which strand paricipates in the in the synthesis of the complementary mRNA strand? 5. Are thymine (T) bases found in RNA? If not...
  9. Y

    plz help in Biology -------->?

    6. What organelle carries out protein synthesis? 7. What is translation? 8. What does the 't' in tRNA stand for? 9. What is tRNA, what is its function? 10.When does translation stop?
Back
Top