Search results

Need someone to booost with in mw2 on the PS3 Only my psn is : X-Nuclear_Taco If ur gonna boost with me send a frined request and tell me ! Dont be a douche bag !

I have installed an experimental IME (a Chinese input method) on my Mac but today it made my Mac hang when I press Cmd+Space to switch into it. I restarted and tried again, it still hangs whenever I switch into it. What's worse, in my third restart, it somehow became my default input method at...

Hi, I have a 90 Crx Hf, with a b18b1.. When i havent been driving it for a while, lets say 6 hours, and i have to warm it up to finally drive off, as soon as i take off the car boggs and its as if the throttle body is closed and after a second it feels as if it opens and the car takes off...

Ok, i feel dumb about this question but its pretty much common sense but it still hasnt hit me. So the headers connect to the back pack of the trubo which then the turbo itself connects to the intercooler, which then rides back up the engine bay to the intake manifold, right? If not plz tell me...

Sounds like a daft question, but the little stalk that you push in (the clear plastic one), which the black plastic base screws into, feels like its stuck in there. How the heck do you get it out? I've tried pulling it hard, but I don't want to break the stand or anything. I need to move this...

0 I have a file called 1.txt with the format for each line is like route+node i.e 190.227.163.142to190.227.163.142asn7303 7303 the 1st column is the route and the 2nd column will be a specific node number which is unique for one route. I wanner use perl script to generate another file called...

0 I have a file called 1.txt with the format for each line is like route+node i.e 190.227.163.142to190.227.163.142asn7303 7303 the 1st column is the route and the 2nd column will be a specific node number which is unique for one route. I wanner use perl script to generate another file called...

0 I have a file called 1.txt with the format for each line is like route+node i.e 190.227.163.142to190.227.163.142asn7303 7303 the 1st column is the route and the 2nd column will be a specific node number which is unique for one route. I wanner use perl script to generate another file called...

If you are not wealthy enough to get into a "Christian school", can't find a bible school, or no homeschool... should you drop out of school to learn about Christ with all the time you didn't have to go to school? Yes you may say this person is a radical Christian but aren't we not suppose to...

0 I have a file called 1.txt with the format for each line is like route+node i.e 190.227.163.142to190.227.163.142asn7303 7303 the 1st column is the route and the 2nd column will be a specific node number which is unique for one route. I wanner use perl script to generate another file called...

The protein sequence A is encoded in the DNA sequence B. For example: a protein sequence FICEDDPKQR is encoded in the () part of the DNA sequence ATGAAAATT(TTCATTTGCGAAGACGATCCAAAACAAAGA)GAAAACATGGTTACC I wanner use Perl to extract the encoding part and save it into a new DNA sequence file

0 I have a file called 1.txt with the format for each line is like route+node i.e 190.227.163.142to190.227.163.142asn7303 7303 the 1st column is the route and the 2nd column will be a specific node number which is unique for one route. I wanner use perl script to generate another file called...

This question is to get an idea of what i might be looking for in the future so don't worry about money wise..( unless its something outrageous like an engine of 10K or more..) Ive heard lots of good ideas but then lots of bad ones too.. like going for the K series even though engines now are...