Search results

  1. C

    hexamer primers for PCR URGENT help?

    consider the following sequence: 5' CACCATCGTCAGTTATCGCCAAGC 3' 3' GTGGTAGCAGTCAATAGCGGTTCG 5' write the sequence of two hexamer (six-nucleotide) primers that can be used to amplify via PCR the exact sequence above (the sequence above will be the final PCR product). be sure to designate the 5'...
  2. C

    Physics problem, URGENT help?

    A bathysphere used for deep-sea exploration has a radius of 1.51 m and a mass of 1.22 104 kg. To dive, this submarine takes on mass in the form of sea water. Determine the amount of mass that the submarine must take on if it is to descend at a constant speed of 1.00 m/s, when the resistive...
Back
Top