Recent content by Kayeee

  1. K

    BIOLOGY - Sketch the protein that is coded by the following DNA sequence.?

    the protein is coded by the DNA sequence CCTGAAGGTACGTTAGTTGACATGACG To make this sketch remember that a short chain of amino acid "looks" like a string--and it's flexible like a string too. If you allow 1/2 inch of the string to represent one amino acid, nine amino acids would make the string...
  2. K

    what is a good blurb describing from a dominant view of the president?

    A blurb for a movie that explores a dominant view of the president . pleaseee answer :] well appreciated .
  3. K

    create a blurb for a movie that explores a:?

    a) Dominant vew of the current (american) president b) Resistant view of the curren (american) president
  4. K

    create a blurb for a movie that explores a:?

    a) Dominant vew of the current (american) president b) Resistant view of the curren (american) president
See more
Back
Top